SUCNR1 cloning plasmid

Supplier: Gentaur

0.01 GBP
Catalog: 399-CSB-CL022921HU-10ug Stock:On request
Product Size: 10ug

You may also be interested


A cloning plasmid for the SUCNR1 gene.



  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1005
  • Sequence: atgctggggatcatggcatggaatgcaacttgcaaaaactggctggcagcagaggctgccctggaaaagtactacctttccattttttatgggattgagttcgttgtgggagtccttggaaataccattgttgtttacggctacatcttctctctgaagaactggaacagcagtaatatttatctctttaacctctctgtctctgacttagcttttctgtgcaccctccccatgctgataaggagttatgccaatggaaactggatatatggagacgtgctctgcataagcaaccgatatgtgcttcatgccaacctctataccagcattctctttctcacttttatcagcatagatcgatacttgataattaagtatcctttccgagaacaccttctgcaaaagaaagagtttgctattttaatctccttggccatttgggttttagtaaccttagagttactacccatacttccccttataaatcctgttataactgacaatggcaccacctgtaatgattttgcaagttctggagaccccaactacaacctcatttacagcatgtgtctaacactgttggggttccttattcctctttttgtgatgtgtttcttttattacaagattgctctcttcctaaagcagaggaataggcaggttgctactgctctgccccttgaaaagcctctcaacttggtcatcatggcagtggtaatcttctctgtgctttttacaccctatcacgtcatgcggaatgtgaggatcgcttcacgcctggggagttggaagcagtatcagtgcactcaggtcgtcatcaactccttttacattgtgacacggcctttggcctttctgaacagtgtcatcaaccctgtcttctattttcttttgggagatcacttcagggacatgctgatgaatcaactgagacacaacttcaaatcccttacatcctttagcagatgggctcatgaactcctactttcattcagagaaaagtga


Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.


  • Gene name: SUCNR1
  • Gene ID: 56670
  • Accession number: BC030948
  • Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

For research use only.

0 reviews for Cusabio

Add a review

Your email address will not be published.