NETO2 cloning plasmid

Supplier: Gentaur

0.01 GBP
Catalog: 399-CSB-CL818759HU-10ug Stock:On request
Product Size: 10ug

You may also be interested


A cloning plasmid for the NETO2 gene.



  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 447
  • Sequence: atggcttgcaaaaccgcttttaataaaaccgggttccaagaagtgtttgatcctcctcattatgaactgttttcactaagggacaaagagatttctgcagacctggcagacttgtcggaagaattggacaactaccagaagatgcggcgctcctccaccgcctcccgctgcatccacgaccaccactgtgggtcgcaggcctccagcgtcaaacaaagcaggaccaacctcagttccatggaacttcctttccgaaatgactttgcacaaccacagccaatgaaaacatttaatagcaccttcaagaaaagtagttacactttcaaacagggacatgagtgccctgagcaggccctggaagaccgagtaatggaggagattccctgtgaaatttatgtcagggggcgagaagattctgcacaagcatccatatccattgacttctaa


Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.


  • Gene name: NETO2
  • Gene ID: 81831
  • Accession number: BC012381
  • Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

For research use only.

0 reviews for Cusabio

Add a review

Your email address will not be published.