BATF3 cloning plasmid

Supplier: Gentaur

0.01 GBP
Catalog: 399-CSB-CL882082HU-10ug Stock:On request
Product Size: 10ug

You may also be interested


A cloning plasmid for the BATF3 gene.



  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 384
  • Sequence: atgtcgcaagggctcccggccgccggcagcgtcctgcagaggagcgtcgcggcgcccgggaaccagccgcagccgcagccgcagcagcagagccctgaggatgatgacaggaaggtccgaaggagagaaaaaaaccgagttgctgctcagagaagtcggaagaagcagacccagaaggctgacaagctccatgaggaatatgagagcctggagcaagaaaacaccatgctgcggagagagatcgggaagctgacagaggagctgaagcacctgacagaggcactgaaggagcacgagaagatgtgcccgctgctgctctgccctatgaactttgtgccagtgcctccccggccggaccctgtggccggctgcttgccccgatga


Transported on ice packs. For long term storage keep frozen at -20°C. Avoid repeat freezing and thawing.


  • Gene name: BATF3
  • Gene ID: 55509
  • Accession number: BC117489
  • Vector: Vector will be determined during the manufacturing process, either pENTR223.1 or pUC

For research use only.

0 reviews for Cusabio

Add a review

Your email address will not be published.